rs328087 chr8:26467565 A>G
- Sequence
cccaccctggtgcctccccatgtg[A/G]ccctgcgtggtgtgccgtacttcc
- ASB in cell types
- NB4 (acute promyelocytic leukemia )
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NB4 (acute promyelocytic leukemia ) | -1.27 | 1.32 | 1.50 |
Items per page:
1 – 1 of 1