rs330648 chr2:150048157 A>G
- Sequence
agctgtcccttcgggatttccata[A/G]acattccattaatgtgctatcccc
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- COE3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE3_HUMAN | 1.43 | -1.52 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alzheimers disease, cystatin c in serum, hdl cholesterol, variant creutzfeldt-jakob disease