rs331610 chr20:57047803 A>G
- Sequence
cccttctggatattacatcccggc[A/G]gagagacagagacagcgttccagt
- ASB in cell types
- SK-BR-3 (breast adenocarcinoma)
- ASB for transcription factors
- ERR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERR1_HUMAN | -0.53 | 1.69 | 2.80 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, asthma, birth weight, hypertension (early onset hypertension), mitral annular calcium, parkinsons disease (pd), salmonella-induced pyroptosis, total cholesterol