rs33180 chr12:30844959 G>A
- Sequence
gagaatcgcttgaatctgggaggc[G/A]gagtttgcggtgagccgagatggc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.26 | 0.61 | 2.01 | |||
| foreskin keratinocyte | -2.77 | 1.75 | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Whole_Blood