rs333097 chr18:7177385 G>T
- Sequence
ctagctaacaggaaccctgtgaag[G/T]gagcacaaattcagatttaaacct
- ASB in cell types
- foreskin keratinocyte SK-N-SH (neuroblastoma) HCT-116 (colon carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.55 | n/a | 2.50 | |||
| SK-N-SH (neuroblastoma) | 1.29 | 0.61 | 1.42 | |||
| HCT-116 (colon carcinoma) | n/a | 1.79 | 1.33 | |||
| HEK293 (embryonic kidney) | -0.32 | 0.93 | 2.15 |
Items per page:
1 – 4 of 4