rs333615 chr8:55886397 A>G
- Sequence
gggattacaggcatgcaccaatgc[A/G]ccaccatgcccggctaatttttgt
- ASB in cell types
- GM12878 (female B-cells) MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.47 | 0.75 | 1.30 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.09 | 1.05 | 2.05 | |||
| K562 (myelogenous leukemia) | -0.21 | 0.66 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid