rs335405 chr6:155340686 G>A
- Sequence
ttctggctcagatgagcctggtga[G/A]gacccaaggagggtactggggctg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.25 | 0.82 | 1.60 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, stabilized warfarin dose, waist hip ratio