rs336257 chr13:109869805 C>G
- Sequence
tcagacaaaagacagagcggccga[C/G]tgggctcagcggacacacagcgca
- ASB in cell types
- epithelial cell of prostate pancreas gastroesophageal sphincter keratinocytes
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.61 | 0.59 | 1.42 | n/a | No Hit | |||
| RAD21_HUMAN | n/a | 1.66 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, infant head circumference, ldl cholesterol change with statins, total cholesterol change with statins