rs336545 chr3:161342719 C>T
- Sequence
gccatcatcttacagtataaatga[C/T]atcacattccttgcacatcacccc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.28 | n/a | 2.50 | -5.12 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP hip bone mineral density (bmd), late onset alzheimers disease, stabilized warfarin dose, total cholesterol, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid