rs33685 chr5:16509227 G>A
- Sequence
tgtttggagaacgcctagccactc[G/A]gcaaaaagatcccttactcaaaaa
- ASB in cell types
- K562 (myelogenous leukemia) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | 0.22 | 1.39 | |||
| LHSAR (prostate epithelial cells) | -2.09 | 1.51 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, hdl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood