rs337374 chr5:177463415 G>A
- Sequence
cccagagggaggagagagatcaac[G/A]cactaaccacatgggtcaaagcca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.98 | -0.43 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, advanced age-related macular degeneration, college completion, factor xii antigen, infant head circumference, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood