rs339404 chr19:6745094 T>C
- Sequence
ccccagccgcctgaacgccgagtc[T/C]cgggcaggaattttcctcttggct
- ASB in cell types
- tibial nerve
- ASB for transcription factors
- CTCF_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.43 | 1.03 | 1.27 | n/a | No Hit | |||
| EP300_HUMAN | 0.15 | 1.04 | 1.46 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), height (pygmy height), ldl cholesterol, longstanding arthritis, refractive error, schizophrenia, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid