rs33982895 chr16:51153231 G>A
- Sequence
tcgtgtactccggacctgtactgc[G/A]ctccggtagaggacccttcccttt
- ASB in cell types
- HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.26 | 0.68 | 1.83 | |||
| bipolar neuron | -1.48 | 1.64 | 1.00 |
Items per page:
1 – 2 of 2