rs33999254 chr14:96699371 G>A
- Sequence
agtgtcatctcaggctctccccac[G/A]gcagccccgtgagaaaggtctcat
- ASB in cell types
- GM12878 (female B-cells) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.33 | 0.67 | 1.32 | |||
| foreskin keratinocyte | 1.32 | -0.89 | 2.50 |
Items per page:
1 – 2 of 2