rs340005 chr15:60585831 G>A
- Sequence
agttacatttctgataaccatgaa[G/A]aacaacgagttaaacttttgaatc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 0.81 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI c-reactive protein levels, c-reactive protein levels or ldl-cholesterol levels (pleiotropy), gamma glutamyl transferase levels, gamma glutamyl transferase levels in low alcohol consumption
GRASP alanine aminotransferase (alt) activity in adolescents, aspartate aminotransferase (ast) activity in adolescents, body mass index (bmi), hdl cholesterol, ldl cholesterol, serum gamma-glutamyl transferase (ggt) activity, serum gamma-glutamyl transferase (ggt) activity (in adolescents), serum gamma-glutamyl transferase (ggt) activity (in adults), total cholesterol