rs340046 chr5:145825917 T>G
- Sequence
taacctgaatattcatgttttaat[T/G]catgaaaatttaccaaaactccca
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) neural cell Jurkat (T-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | 1.36 | -1.19 | 2.00 | |||
| neural cell | 0.36 | 0.66 | 1.00 | |||
| Jurkat (T-cells) | 1.54 | -1.43 | 1.33 |
Items per page:
1 – 3 of 3