rs340630 chr4:87037243 G>A
- Sequence
ttgtgaaaagaatttaaaaacaac[G/A]ttaacaaaatgctccccaaaccac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.57 | -0.22 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aff1 gene expression in ebv-transfected b cell lines, asthma, hdl cholesterol, height, late onset alzheimers disease, premature ovarian failure, refractive error, serum creatinine, systemic lupus erythematosus (sle), total cholesterol, triglycerides
PheWAS abnormal heart sounds, abnormal movement, abnormal reflex, abnormal results of function studies, abnormality of red blood cells, acquired deformities of ankle and foot, acute sinusitis, adverse effects of antirheumatics, anemia in chronic kidney disease, anorexia, anticoagulants causing adverse effects, atrophic gastritis, bursitis, calcaneal spur, exostosis nos, cerebrovascular disease, chronic rheumatic disease of the heart valves, congenital anomalies of face and neck, congenital anomalies of posterior segment of eye, dermatophytosis, dermatophytosis / dermatomycosis, dyspepsia and disorders of function of stomach, e. coli, flat foot, fracture of ankle and foot, fracture of foot, fracture of ribs, functional disorders of bladder, gastritis and duodenitis, nos, hallux rigidus, hallux valgus (bunion), hearing loss, hyperventilation, insulin pump user, jaundice, keratitis, infectious, loss of teeth or edentulism, microscopic hematuria, mitral valve stenosis and/or aortic valve stenosis, nerve root and plexus disorders, occlusion and stenosis of precerebral arteries, other acquired musculoskeletal deformity, other derangement of joint, other diseases of the teeth and supporting structures, other disorders of bladder, other dyschromia, paroxysmal supraventricular tachycardia, polycystic ovaries, portal hypertension, rash and other nonspecific skin eruption, renal dialysis, spondylosis without myelopathy, stress fracture, symptoms involving respiratory system, toxic effect of venom, ventricular fibrillation & flutter
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Testis, Thyroid