rs340835 chr1:213990332 G>A
- Sequence
gaccacaatgcttgctcgagggtt[G/A]gagaggtttatgaatttatggttg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.74 | -0.27 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, fasting blood glucose, hdl cholesterol, homa-b, microalbuminuria, obesity with early age of onset (age >2), spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, triglycerides, type 2 diabetes, combined control dataset, urinary albumin-to-creatinine ratio
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Pancreas, Pituitary, Spleen, Stomach, Testis, Thyroid