rs34121942 chr14:20683002 G>A
- Sequence
gaggcccctgggtccgcgcccagt[G/A]aggccaacagccctcgggcgccca
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.26 | 0.97 | 1.79 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.06 | 0.82 | 1.51 |
Items per page:
1 – 2 of 2