rs34132287 chr2:112049512 G>A
- Sequence
ttgccaggcggaccgtggtctagt[G/A]gtagcgtaagtgtcaaggaaaaac
- ASB in cell types
- pancreas MCF10A (breast epithelial cells) adrenal gland thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.03 | -2.26 | 1.33 | |||
| MCF10A (breast epithelial cells) | 2.06 | -1.79 | 1.33 | |||
| adrenal gland | 1.33 | -1.60 | 1.33 | |||
| thyroid gland | 1.79 | -1.43 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood