rs342075 chr2:20506982 T>C
- Sequence
tcgacaacaaaagcgaaacattga[T/C]aaagtgaacctcgtcacaatgaaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.12 | 0.73 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, asthma, diastolic blood pressure (dbp), fasting blood glucose, mitral annular calcium, rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp), tetrology of fallot