rs342301 chr7:106736882 C>T
- Sequence
ctctcagagccatgccagcaacac[C/T]tgccccaggaatctggactatttc
- ASB in cell types
- LNCaP (prostate carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.36 | 1.08 | 1.17 | |||
| GM12878 (female B-cells) | 0.47 | 0.37 | 1.28 |
Items per page:
1 – 2 of 2