rs342940 chr3:146641462 T>C
- Sequence
atacaatttggaaactatttctga[T/C]gcataccccattataaacaatagg
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma) hepatocytes erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.32 | 2.17 | |||
| PC9 (lung adenocarcinoma) | 1.92 | -0.19 | 2.00 | |||
| hepatocytes | 0.95 | -0.58 | 1.00 | |||
| erythroid progenitors | -3.53 | 2.06 | 2.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, total cholesterol change with statins, triglycerides, waist hip ratio, years of education