rs343109 chr5:73565541 G>A
- Sequence
tctctccttttttttaatattttt[G/A]tttttgccgcctttacgctccgag
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) breast tumor tissue cranial neural crest cells
- ASB for transcription factors
- NR2C1_HUMAN AP2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | 2.52 | -0.65 | 1.78 | n/a | No Hit | |||
| AP2A_HUMAN | 1.86 | -1.43 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, ldl cholesterol, urinary albumin-to-creatinine ratio