rs34324 chr12:12724992 C>A
- Sequence
agaaccgaaagtgccgagttgaca[C/A]gtaaggcccagcccctctgcggcc
- ASB in cell types
- fetal bone marrow-derived mononuclear cells GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 1.84 | n/a | 1.50 | |||
| GM12878 (female B-cells) | 0.54 | 0.25 | 1.31 |
Items per page:
1 – 2 of 2