rs34330 chr12:12717761 T>C
- Sequence
tgggcttccgagaggggttcgggc[T/C]gcgtaggggcgctttgttttgttc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.61 | 1.09 | 1.69 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), ldl cholesterol change with statins, maternal transmission distortion, neuroblastoma (brain cancer), spine bone mineral density (bmd), systemic lupus erythematosus (sle), total cholesterol change with statins, transmission distortion