rs34341121 chr19:54319085 C>T
- Sequence
gctaaaatctaaaaagaaaaccca[C/T]aaaaaaccctaaatgtaatgacgt
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.62 | -0.15 | 2.00 |
Items per page:
1 – 1 of 1