rs343796 chr1:110766008 A>T
- Sequence
tttaaaattatgtgtttgattttt[A/T]aaaaatctaaagtagaaaagggag
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.59 | 1.59 | 1.83 | |||
| PC9 (lung adenocarcinoma) | -0.65 | 1.36 | 1.50 |
Items per page:
1 – 2 of 2