rs344775 chr19:43674478 G>C
- Sequence
tgaagtgggcacttccctggctgg[G/C]tcaccctgggccaatgacattctt
- ASB in cell types
- periferal blood macrophages
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -3.50 | 2.17 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1