rs34490902 chr2:219552220 G>C
- Sequence
gcaccagaatgtgtttcttccctg[G/C]gggtgagggggtcgctagcgaggc
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.31 | 0.74 | 1.98 | |||
| HEK293 (embryonic kidney) | 0.34 | 0.47 | 1.27 | |||
| bipolar neuron | -1.46 | 1.81 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Heart_Atrial_Appendage, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis