rs34647 chr5:72816603 C>G
- Sequence
gcgaccgccgccgaatgttcccgc[C/G]gcgggctccgccccccggccaatc
- ASB in cell types
- thymus-derived CD34- cells CD14+ monocytes breast tumor tissue
- ASB for transcription factors
- BC11B_HUMAN ESR1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BC11B_HUMAN | n/a | 2.60 | 2.50 | n/a | n/a | |||
| ESR1_HUMAN | n/a | 2.46 | 2.50 | n/a | No Hit | |||
| STAT1_HUMAN | -2.74 | 1.72 | 2.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, parkinsons disease, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial