rs348288 chr20:49187226 A>G
- Sequence
aagctggatgatggcggggcgggg[A/G]gaaatggacaggttgctcatcctg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.52 | 0.30 | 1.25 | |||
| GM12878 (female B-cells) | 1.15 | -0.44 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Pancreas, Testis, Thyroid, Whole_Blood