rs348347 chr19:6564391 A>G
- Sequence
tccccagactccagatgaaaacac[A/G]gcttggtcaactccttgattgtat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.75 | -0.33 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, hdl cholesterol, irritible bowel syndrome, ldl cholesterol change with statins, sporadic creutzfeldt-jakob disease, years of education