rs348384 chr19:6552375 C>T
- Sequence
ggctctcccaggaggttttcatga[C/T]gtaacctgccaatttgataaatct
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF7_HUMAN PBX2_HUMAN MEIS2_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | 2.30 | -2.53 | 1.33 | n/a | n/a | |||
| PBX2_HUMAN | 2.34 | n/a | 2.00 | n/a | No Hit | |||
| MEIS2_HUMAN | 2.29 | n/a | 2.00 | n/a | No Hit | |||
| REQU_HUMAN | 1.84 | -1.08 | 1.67 | n/a | n/a | |||
| IKZF2_HUMAN | 0.91 | -1.41 | 1.33 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), forward wave amplitude, ldl cholesterol change with statins, maternal transmission distortion, obesity with early age of onset (age >2), refractive error, transmission distortion, triglycerides change with statins