rs34843175 chr8:125729252 C>G
- Sequence
aaagttgggagtctcaaattcaag[C/G]ttaccttcaacaatctgtttggtc
- ASB in cell types
- foreskin keratinocyte MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.27 | -1.96 | 2.17 | |||
| MCF7 (Invasive ductal breast carcinoma) | -2.20 | 1.94 | 1.50 |
Items per page:
1 – 2 of 2