rs348803 chr20:60463934 T>C
- Sequence
gaatcagagaaatcaggatattat[T/C]caacaatgtctttagatccaggtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-231 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.50 | -0.60 | 3.53 | |||
| MDA-MB-231 (breast adenocarcinoma) | -3.24 | 1.75 | 2.50 |
Items per page:
1 – 2 of 2