rs34888500 chr19:33274489 G>A
- Sequence
tgggtacgcatgtgactgtagtgt[G/A]tgtgactgtgtgtgtgcacgtgtg
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.57 | -0.37 | 4.57 | |||
| A549 (lung carcinoma) | 0.09 | 0.98 | 1.94 |
Items per page:
1 – 2 of 2