rs34889979 chr2:112041657 G>A
- Sequence
aagcagtggcctttttcttatctc[G/A]tttgtcctgttctgcctgctcctc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTBP1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTBP1_HUMAN | 2.41 | -2.68 | 1.33 | n/a | n/a | |||
| GATA3_HUMAN | 2.08 | -1.99 | 1.33 | 1.62 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood