rs34995301 chr8:22562042 G>C
- Sequence
cggcacagcctcggagcccagcca[G/C]gagtggggtctcacttccgtgtcc
- ASB in cell types
- lymphoblastoid cells GM19240 (B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| lymphoblastoid cells | 1.23 | -0.19 | 1.33 | |||
| GM19240 (B-cells) | 1.62 | -1.23 | 1.33 |
Items per page:
1 – 2 of 2