rs35003 chr5:16616990 A>G
- Sequence
cgccatcttcagctgtgcttccag[A/G]cagggacggggccgggcgcgcgcg
- ASB in cell types
- A549 (lung carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.56 | 1.71 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.71 | -0.25 | 2.93 |
Items per page:
1 – 2 of 2