rs350141 chr19:925530 A>T
- Sequence
aggtgctccgtaagaagggaagag[A/T]cttggtcccggatctggctccgat
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.24 | 0.45 | 1.95 | |||
| HepG2 (hepatoblastoma) | 0.17 | 0.49 | 1.22 | |||
| CD14+ monocytes | -3.74 | 1.97 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial