rs351739 chr6:109182773 A>G
- Sequence
gtgaagtgttgaaactgatcaaga[A/G]atgaaggcagaatgtccgtccttt
- ASB in cell types
- LHSAR (prostate epithelial cells) K562 (myelogenous leukemia)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.12 | 1.01 | 1.65 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, hip bone mineral density (bmd), longstanding arthritis, mean corpuscular hemoglobin concentration (mchc), mitral annular calcium, postoperative nausea and vomiting, refractive error, triglycerides change with statins, years of education
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood