rs351775 chr8:28333590 T>C
- Sequence
agtcaagagttgagatgattttgt[T/C]agcatctaatttatctaacagtgc
- ASB in cell types
- CLB-Ga (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CLB-Ga (neuroblastoma) | 1.21 | -0.95 | 1.33 |
Items per page:
1 – 1 of 1