rs35227715 chr16:87391825 C>G
- Sequence
cgggcgagcggcgaccctgcctcc[C/G]ggagacggcgcggcctgccctgcg
- ASB in cell types
- GM12878 (female B-cells) macrophages CD14+ monocytes
- ASB for transcription factors
- COT1_HUMAN STAT1_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -1.61 | 1.41 | 1.33 | n/a | No Hit | |||
| STAT1_HUMAN | 1.44 | 0.75 | 1.75 | n/a | No Hit | |||
| CEBPB_HUMAN | 1.19 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid