rs35347194 chr8:49205747 C>G
- Sequence
tgtgttcccaagggcaaagtgaca[C/G]aacatcatgtatcatttttgcatg
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 2.09 | n/a | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid