rs353810 chr9:86414276 A>C
- Sequence
atcttgccttcaggataatgtgaa[A/C]tatggcctaatttttgaagttttt
- ASB in cell types
- B-cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| B-cells | 1.79 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, arthritis including non-rheumatoid, bipolar disorder, height, homa-b, homa-ir, ldl cholesterol, longstanding arthritis, spine bone mineral density (bmd), stabilized warfarin dose