rs353917 chr5:77770453 G>C
- Sequence
atgttagctagttacagaagaggt[G/C]accaatcattccagtttgcctggg
- ASB in cell types
- BEAS-2B (bronchial epithelium)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| BEAS-2B (bronchial epithelium) | 1.73 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood