rs354067 chr7:149624064 A>G
- Sequence
aggacagactaaggcctcaacagg[A/G]cttggtgcagtacctggctctata
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) HEK293T (embryonic kidney)
- ASB for transcription factors
- HDAC1_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | -0.75 | 1.71 | 1.50 | n/a | n/a | |||
| NFIC_HUMAN | -1.93 | 1.69 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood