rs35422592 chr10:71956249 C>T
- Sequence
gacaagaatgcgagccctctgtca[C/T]gcccagacagggccactagagggc
- ASB in cell types
- hepatocytes HCT-116-RAD21-mAC prostate gland smooth muscle cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -0.07 | 1.46 | 1.33 | |||
| HCT-116-RAD21-mAC | 1.16 | -0.63 | 1.33 | |||
| prostate gland | -1.38 | 1.17 | 1.33 | |||
| smooth muscle cell | -1.54 | 1.86 | 1.33 |
Items per page:
1 – 4 of 4