rs35504625 chr1:154627302 C>G
- Sequence
acaggctgagcgcggcggccgtga[C/G]cccgcagtgagctttccacagtgg
- ASB in cell types
- HEK293 (embryonic kidney) MDA-MB-453 (breast adenocarcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.13 | -0.88 | 2.17 | -3.50 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
